View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-18 (Length: 128)
Name: Solexa-NF5866-18
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 32955981 - 32955858
Alignment:
| Q |
8 |
gcataatggagtcaggaaacttctacagtaacaacaacaacaa---ttcatggtactcacaaccacagagtcaaatgtatggcaatgagctacgtttcat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32955981 |
gcataatggagtcaggaaacttctacagtaacaacaacaacaacaattcatggtactcacaaccacagagtcaaatgtatggcaatgagctacgtttcat |
32955882 |
T |
 |
| Q |
105 |
ggatgattcagatgcagaatcaga |
128 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32955881 |
ggatgattcagatgcagaatcaga |
32955858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University