View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-24 (Length: 125)
Name: Solexa-NF5866-24
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 17802611 - 17802495
Alignment:
| Q |
8 |
atatgcatggaggcacatgtaaagtagtagaccccataatttgatttggttggcatgttcgatg--tatcaagttctatttaaggcaagggattgcacac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17802611 |
atatgcatggaggcacatgtaaagtagtagaccccatagtttgatttggttgccatgttcgatgtatatcaagttctatttaaggcaagggattgcacac |
17802512 |
T |
 |
| Q |
106 |
actttcttcacatcaac |
122 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17802511 |
actttcttcacatcaac |
17802495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University