View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-27 (Length: 109)
Name: Solexa-NF5866-27
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 39166414 - 39166515
Alignment:
| Q |
8 |
tttacgaatccacacaaacgcatattctaaaaaagatgaagggtgtataaagaatgtgaggcatcggtggagatgtacacggtctacttcaagattcgta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166414 |
tttacgaatccacacaaacgcatattctaaaaaagatgaagggtgtataaagaatgtgaggcatcggtggagatgtacacggtctacttcaagattcgta |
39166513 |
T |
 |
| Q |
108 |
tt |
109 |
Q |
| |
|
|| |
|
|
| T |
39166514 |
tt |
39166515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University