View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-28 (Length: 96)
Name: Solexa-NF5866-28
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-28 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 2e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 51150594 - 51150685
Alignment:
| Q |
5 |
atcatagatttcgcaggtaagtgcatgtgtctatccgaggacatataactatatgcttcttttatttctcttctgtaaattgaacaaatgaa |
96 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51150594 |
atcatagattttgcaggtaagtgcatgtgtctatccgaggacatataactatatgcttcttttctttctcttctgtaaattgaacaaatgaa |
51150685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 51162895 - 51162986
Alignment:
| Q |
5 |
atcatagatttcgcaggtaagtgcatgtgtctatccgaggacatataactatatgcttcttttatttctcttctgtaaattgaacaaatgaa |
96 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51162895 |
atcatagattttgcaggtaagtgcatgtgtctatccgaggacatataactatatgcttcttttctttctcttctgtaaattgaacaaatgaa |
51162986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University