View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-4 (Length: 210)
Name: Solexa-NF5866-4
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 6005751 - 6005549
Alignment:
| Q |
8 |
tatttcagtacatgagggtgcagaaaaccctcaaaaagtgcgcccctgggatggacctttcctttgctttagttgccaggagaagaaagaagccatggaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6005751 |
tatttcagtacatgagggtgcagaaaaccctcaaaaagtgcgcccctgggatggacctttcctttgctttagttgccaggagaagaaagaagccatggaa |
6005652 |
T |
|
| Q |
108 |
gggaaaagatcattaggtannnnnnnnataacccctcttcatttctgtccatcttccttgaaatatgtgtccataatctaatccactatcttggtctttt |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6005651 |
gggaaaagatcattaggtattttttttataacccctcttcatttctgtccatcttccttgaaatatgtgtccataatctaatccactatcttggtctttt |
6005552 |
T |
|
| Q |
208 |
cat |
210 |
Q |
| |
|
||| |
|
|
| T |
6005551 |
cat |
6005549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 51 - 113
Target Start/End: Original strand, 46737951 - 46738013
Alignment:
| Q |
51 |
ccctgggatggacctttcctttgctttagttgccaggagaagaaagaagccatggaagggaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
46737951 |
ccctgggatggacctttcctttgcttaagttgccaaaagaagaaagaagccatggaagggaaa |
46738013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University