View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-6 (Length: 186)
Name: Solexa-NF5866-6
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 4117928 - 4117819
Alignment:
| Q |
8 |
ttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgcgaagtgatggctcaccacagcatccagtatcctaccat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4117928 |
ttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgcgaagtgatggctcaccacagcatccagtatcctaccat |
4117829 |
T |
|
| Q |
108 |
tgtttaactg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
4117828 |
tgtttaactg |
4117819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 21157233 - 21157121
Alignment:
| Q |
8 |
ttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgcgaagtgatggctcaccacagcatccagtatcctaccat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21157233 |
ttattactatctataaattacattattcccttgctcttgcttgcctcattcatcacccctgtgaagtgatggctcatcacagcatccagtatcctaccat |
21157134 |
T |
|
| Q |
108 |
tgtttaactggta |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21157133 |
tgtttaactggta |
21157121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University