View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5867-12 (Length: 127)

Name: Solexa-NF5867-12
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5867-12
Solexa-NF5867-12
[»] chr4 (1 HSPs)
chr4 (8-127)||(20817285-20817404)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 20817404 - 20817285
Alignment:
8 gcattcagttaagtgaatgttggcatcttattggtgtcttaagagtaaaggcaatgtttcatttcatttcatccacttataattaattctttgatagcct 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20817404 gcattcagttaagtgaatgttggcatcttattggtgtcttaagagtaaaggcaatgtttcatttcatttcatccacttataattaattctttgatagcct 20817305  T
108 tgtagattggacctatgtca 127  Q
    ||| ||||||||||||||||    
20817304 tgtggattggacctatgtca 20817285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University