View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5867-14 (Length: 127)
Name: Solexa-NF5867-14
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5867-14 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 21215113 - 21214994
Alignment:
| Q |
8 |
acatgacatgatatattaccatttcacattcatatgtcatacttccgccggagatacacatgtctcgaggccacttgataggaggcccttgataagcttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21215113 |
acatgacatgatatattaccatttcacattcatatgtcatacttccgccggagatacacatgtctcgaggccacttgacaggaggcccttgataagcttg |
21215014 |
T |
|
| Q |
108 |
atgttaaggagcatggggac |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21215013 |
atgttaaggagcatggggac |
21214994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 18060280 - 18060324
Alignment:
| Q |
15 |
atgatatattaccatttcacattcatatgtcatacttccgccgga |
59 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||| ||||| |
|
|
| T |
18060280 |
atgatatattaccatttcaaatccatatgtcatacctccaccgga |
18060324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 1783181 - 1783224
Alignment:
| Q |
8 |
acatgacatgatatattaccatttcacattcatatgtcatactt |
51 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
1783181 |
acatgagatgatattttaccatttcacatcaatatgtcatactt |
1783224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University