View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5867-15 (Length: 126)
Name: Solexa-NF5867-15
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5867-15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 21 - 125
Target Start/End: Complemental strand, 32291706 - 32291602
Alignment:
| Q |
21 |
ttaaaaagttgatattattattaattacaagtgtttcttaggatgcttccaattacatggtggtgaaaaacacgtacctgatgataatgacacatcaaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32291706 |
ttaaaaagttgatattattattaattacaagtgtttcttaggatgcttccaattacatggtggtgaaaaacacgtacctgatgataatgacacatcaaaa |
32291607 |
T |
 |
| Q |
121 |
tcaaa |
125 |
Q |
| |
|
||||| |
|
|
| T |
32291606 |
tcaaa |
32291602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University