View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5867-20 (Length: 61)
Name: Solexa-NF5867-20
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5867-20 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 5e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 5e-27
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 5395514 - 5395574
Alignment:
| Q |
1 |
cagagacatcgcattgaatgtagtgaacatacttatcagcgttccacgttggttgtggacg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395514 |
cagagacatcgcattgaatgtagtgaacatacttatcagcgttccacgttggttgtggacg |
5395574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 5391703 - 5391764
Alignment:
| Q |
1 |
cagagacatcgcattgaatgtagtgaacatacttatcagcgttccacg-ttggttgtggacg |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
5391703 |
cagagacatcgcattgaatgtagtcaacataattatcagtgttccacgtttggttgtggacg |
5391764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University