View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5867-9 (Length: 141)
Name: Solexa-NF5867-9
Description: NF5867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5867-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 7 - 141
Target Start/End: Complemental strand, 13984118 - 13983984
Alignment:
| Q |
7 |
aggaacaaggagttaacgcccgcattttccatcctaatgagcttaatatcattagttccattctctgaattgttttagcttggaatacaaatttcggttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13984118 |
aggaacaaggagttaacgcccgcattttccatcccaatgagcttaatatcattagttccattctctgaattgttttagcttggaatacaaattttggttc |
13984019 |
T |
 |
| Q |
107 |
tccaacctgtgcattatcgatatcaatgagaaaat |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13984018 |
tccaacctgtgcattatcgatatcaatgagaaaat |
13983984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University