View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-1 (Length: 221)
Name: Solexa-NF5868-1
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 3710587 - 3710384
Alignment:
| Q |
8 |
gtagattgttaatttatgtagatctaaccttattgttgcgtgtcaatgattccaaaaaacgggtactacacatcttcttgataaaattgtctgaaatgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710587 |
gtagattgttaatttatgtagatctaaccttattgttgcgtgtcaatgattccaaaaaacgggtactacacatcttcttgataaaattgtctgaaatgcc |
3710488 |
T |
 |
| Q |
108 |
ttctaggtcgaattgtaggggtcggatggtccgaataccatttttgtgggtcgttgatagagtttattcttgggaacacgctcgaatgcatatgattccc |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710487 |
ttctaggtcgacttgtaggggtcggatggtccgaataccatttttgtgggtcgttgatagagtttattcttgggaacacgctcgaatgcatatgattccc |
3710388 |
T |
 |
| Q |
208 |
tttg |
211 |
Q |
| |
|
|||| |
|
|
| T |
3710387 |
tttg |
3710384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University