View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5868-12 (Length: 127)

Name: Solexa-NF5868-12
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5868-12
Solexa-NF5868-12
[»] chr2 (1 HSPs)
chr2 (11-127)||(25544205-25544321)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 3e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 11 - 127
Target Start/End: Complemental strand, 25544321 - 25544205
Alignment:
11 gtcaccattattttggaaattgaagcggtttttaacattgaatagtttcaacattgaactaatcaatgttnnnnnnncttttcaacctccacaataatga 110  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| ||||||||       |  ||||||||||||||||||||    
25544321 gtcaccattattttggaaatggaagcgttttttaacattgaatagtttaaacattgaactattcaatgttaaaaaaacgattcaacctccacaataatga 25544222  T
111 caccattattgctcatt 127  Q
    |||||||||||||||||    
25544221 caccattattgctcatt 25544205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University