View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-13 (Length: 123)
Name: Solexa-NF5868-13
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 195401 - 195517
Alignment:
| Q |
8 |
caaactagttaacggctgattttgcttgggacgttcaagttatgaccaaagctttcttgacagcttgtattgtattgagc-ttgctattttttccatgta |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
195401 |
caaactagttaacggctgattttgctagggacgttcaagttatgaccaaagctttcttgacaacttgtattgtattgagctttgctatattttacatgta |
195500 |
T |
 |
| Q |
107 |
cttgtgtgtctagaaat |
123 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
195501 |
cttgtgtgtctagaaat |
195517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University