View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5868-13 (Length: 123)

Name: Solexa-NF5868-13
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5868-13
Solexa-NF5868-13
[»] chr5 (1 HSPs)
chr5 (8-123)||(195401-195517)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 195401 - 195517
Alignment:
8 caaactagttaacggctgattttgcttgggacgttcaagttatgaccaaagctttcttgacagcttgtattgtattgagc-ttgctattttttccatgta 106  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| ||||||    
195401 caaactagttaacggctgattttgctagggacgttcaagttatgaccaaagctttcttgacaacttgtattgtattgagctttgctatattttacatgta 195500  T
107 cttgtgtgtctagaaat 123  Q
    |||||||||||||||||    
195501 cttgtgtgtctagaaat 195517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University