View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-14 (Length: 113)
Name: Solexa-NF5868-14
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 36439278 - 36439383
Alignment:
| Q |
8 |
cacgtaccactttcacaaacccttccccatttcgacacgtggacacattcgacttcctcacacacccacccgacccctctctcaaataccattccctctc |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36439278 |
cacgtgccactttcacaaacccttccccatttcgacacgtggacacattcgacttcctcacacacccacccgacccatctctcaaataccattccctctc |
36439377 |
T |
|
| Q |
108 |
aaactt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
36439378 |
aaactt |
36439383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University