View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-16 (Length: 92)
Name: Solexa-NF5868-16
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 36439744 - 36439660
Alignment:
| Q |
8 |
gtttctatacagcaataataaagttccagtatggagaaccgggtcgtggacgggtcaaagatggagtggagtacccgaaatgact |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36439744 |
gtttctatacagcaataataaagttccagtatggagaaccgggtcgtggacgggtcaaagatggagcggagtacccgaaatgact |
36439660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University