View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5868-18 (Length: 81)

Name: Solexa-NF5868-18
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5868-18
Solexa-NF5868-18
[»] chr7 (2 HSPs)
chr7 (8-81)||(38893144-38893217)
chr7 (8-81)||(38883952-38884025)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 38893144 - 38893217
Alignment:
8 gttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtgg 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38893144 gttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtgg 38893217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 38883952 - 38884025
Alignment:
8 gttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtgg 81  Q
    ||||||||||| | |||||||||||||||||| ||||||||||||||||| || ||||| || |||||||||||    
38883952 gttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtgg 38884025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University