View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-18 (Length: 81)
Name: Solexa-NF5868-18
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-18 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 38893144 - 38893217
Alignment:
| Q |
8 |
gttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtgg |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38893144 |
gttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtgg |
38893217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 38883952 - 38884025
Alignment:
| Q |
8 |
gttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtgg |
81 |
Q |
| |
|
||||||||||| | |||||||||||||||||| ||||||||||||||||| || ||||| || ||||||||||| |
|
|
| T |
38883952 |
gttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtgg |
38884025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University