View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-4 (Length: 176)
Name: Solexa-NF5868-4
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 6e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 6e-79
Query Start/End: Original strand, 7 - 176
Target Start/End: Original strand, 46952487 - 46952656
Alignment:
| Q |
7 |
acaaaccaaatcacttttgcaaatagagctcaacactatttcatcttcatttgctggttttagtactcttgtcactcaacttcataggtaaacttttgct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46952487 |
acaaaccaaatcacttttgcaaatagagctcaacactatttcatcttcatttgctggttttagtactcttgtcactcaacttcataggtaaacttttgct |
46952586 |
T |
|
| Q |
107 |
ttaactctaatttattataatctctgattttctcatacttcctcnnnnnnncctttcttttgcgtcctat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46952587 |
ttaactctaatttattataatctctgattttctcatacttcctctttttttcctttcttttgcgtcctat |
46952656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 32541900 - 32541851
Alignment:
| Q |
16 |
atcacttttgcaaatagagctcaacactatttcatcttcatttgctggtt |
65 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
32541900 |
atcacttttgcaaatatagttcatcactatttcatcttcatttgctggtt |
32541851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University