View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-7 (Length: 150)
Name: Solexa-NF5868-7
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 2e-64
Query Start/End: Original strand, 10 - 150
Target Start/End: Complemental strand, 2362454 - 2362313
Alignment:
| Q |
10 |
tctcaccaccttgcaagatattagctgtccagtttttcttttccttttcagtgcttgattccatyttcacccttctc-ttattacccagttagtacatca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||| |
|
|
| T |
2362454 |
tctcactaccttgcaagatattagctgtccagtttttcttttccttttcagtgcttgattccattttcacccttctcatttttacccagttagtacatca |
2362355 |
T |
|
| Q |
109 |
ctgtctacactcagtgaattccctgaacttatcagtactatt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2362354 |
ctgtctacactcagtgaattccctgaacttatcagtactatt |
2362313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University