View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5868-8 (Length: 140)
Name: Solexa-NF5868-8
Description: NF5868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5868-8 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 6e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 2 - 140
Target Start/End: Complemental strand, 1360816 - 1360678
Alignment:
| Q |
2 |
ccaacgttattttatttccacgaggaggctatgctcttccacgagagccatgcaatgattattttattgtaaaatagaaagaagattgtgttttggcctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1360816 |
ccaacgttattttatttccacgaggaggctatgctcttccacgagagccatgcaatgattattttagtgtaaaatagaaagaagattgtgttttggcctt |
1360717 |
T |
|
| Q |
102 |
ttgggattgatactttcactgttggtgttggttcatctc |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
1360716 |
ttgggattgattctttcactgttggtgttggttcttctc |
1360678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 134
Target Start/End: Original strand, 3203441 - 3203475
Alignment:
| Q |
100 |
ttttgggattgatactttcactgttggtgttggtt |
134 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3203441 |
ttttgggatcgatactttcactgttggtgttggtt |
3203475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University