View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5869-1 (Length: 185)
Name: Solexa-NF5869-1
Description: NF5869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5869-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 36668851 - 36668921
Alignment:
| Q |
37 |
aaatattgtattggaccaaatttgttgctttcctacttaagatgttggtttaactagataaaaatattgtatt |
109 |
Q |
| |
|
|||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36668851 |
aaattttgtgttggaccaaatta--tgctttcctacttaagatgttggtttaactagatagaaatattgtatt |
36668921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 98 - 148
Target Start/End: Original strand, 36668851 - 36668901
Alignment:
| Q |
98 |
aaatattgtattggaccaaattatgctttcctacttaagatgttggtttaa |
148 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36668851 |
aaattttgtgttggaccaaattatgctttcctacttaagatgttggtttaa |
36668901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 185
Target Start/End: Original strand, 36668939 - 36668977
Alignment:
| Q |
147 |
aatgtatacataattttgtccagtcgatatgtaaggatc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36668939 |
aatgtatacataattttgtccagtcgatatgtaaggatc |
36668977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University