View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5869-10 (Length: 58)
Name: Solexa-NF5869-10
Description: NF5869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5869-10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 4e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 5811400 - 5811346
Alignment:
| Q |
1 |
gatcttcccagataaaagtttgcattttgtgcattcttcttacagtcttcaatgg |
55 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5811400 |
gatctttccagataaaagtttgcattttgtgcattcttcttacagtcttcaatgg |
5811346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.000000004
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 27736712 - 27736662
Alignment:
| Q |
8 |
ccagataaaagtttgcattttgtgcattcttcttacagtcttcaatggcta |
58 |
Q |
| |
|
|||||||| |||||||||||||| ||||| || || ||||||||||||||| |
|
|
| T |
27736712 |
ccagataatagtttgcattttgttcattcctcgtatagtcttcaatggcta |
27736662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University