View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5869-14 (Length: 50)
Name: Solexa-NF5869-14
Description: NF5869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5869-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 1e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 14553273 - 14553224
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgctaact |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14553273 |
tctttcacacaatagttttatttctatcaacattgatagcagtgctaact |
14553224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-18; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-18
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37702831 - 37702786
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37702831 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
37702786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37594487 - 37594442
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
37594487 |
tctttcacacaatagttttctttctatcaactttgatagcagtgct |
37594442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 37392889 - 37392932
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtg |
44 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37392889 |
tctttcacacaatggttttctttctatcaacattgatagcagtg |
37392932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 37711787 - 37711745
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagt |
43 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37711787 |
tctttcacacaatacttttctttctatcaacattgatagcagt |
37711745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37400875 - 37400920
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37400875 |
tctttcccataatagttttctttctatcaacattgatagcagtgct |
37400920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.00000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37640035 - 37639990
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37640035 |
tctttcccataatagttttctttctatcaacattgatagcagtgct |
37639990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37435870 - 37435825
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
37435870 |
tctttcgcacaatagttttctttctatcaacactaatagcagtgct |
37435825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37696884 - 37696839
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||||||||||| |||| || ||||||||| ||||||||||||| |
|
|
| T |
37696884 |
tctttcacacaatacttttcttgctatcaacactgatagcagtgct |
37696839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37824058 - 37824013
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||||||||||| |||| || ||||||||| ||||||||||||| |
|
|
| T |
37824058 |
tctttcacacaatacttttcttgctatcaacactgatagcagtgct |
37824013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 16842873 - 16842918
Alignment:
| Q |
1 |
tctttcacacaatagttttatttctatcaacattgatagcagtgct |
46 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| |||||||| |||| |
|
|
| T |
16842873 |
tctttcacacaatacttttctttctatcaacactgatagcattgct |
16842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University