View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5869-2 (Length: 153)
Name: Solexa-NF5869-2
Description: NF5869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5869-2 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 2e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 9 - 153
Target Start/End: Original strand, 31377801 - 31377945
Alignment:
| Q |
9 |
atcatataggaaaacaaggagtgtacatcactatcatccttaagaattttaggttggtaaacaacaataactttgtagttattatctgtcatatctatgt |
108 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31377801 |
atcatatatgaaaacaaggattgtacatcgctatcatccttaagaatcttaggttggtaaacaacaatatctttgtagttattatctgtcatatctatgt |
31377900 |
T |
|
| Q |
109 |
atgatacttgaacaacaacatgagatgcaatatgactttcatcag |
153 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31377901 |
atgatacttgaacaacaacatgacatgcaatatgactttcatcag |
31377945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 97 - 136
Target Start/End: Complemental strand, 30486850 - 30486811
Alignment:
| Q |
97 |
tcatatctatgtatgatacttgaacaacaacatgagatgc |
136 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
30486850 |
tcatatctatgtatgatacctgaacaacaacattagatgc |
30486811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University