View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5869-3 (Length: 141)
Name: Solexa-NF5869-3
Description: NF5869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5869-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 7396955 - 7396815
Alignment:
| Q |
1 |
cataggccacaatgaagaaaaatcatagcaagctaaaaataaatgttgtgccatttctatggaaccacaatttgagatacactgagaggcttctgatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7396955 |
cataggccacaatgaagaaaaatcatagcaagctaaaaataaatgttgcgccgtttctatggaaccacaatttgagatacactaagaggcttctgatgag |
7396856 |
T |
|
| Q |
101 |
atgaccgctctcgtcaccaagtttgatttaatagacaatct |
141 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7396855 |
atgacccctctcgtcaccaagtttgatttaatagacaatct |
7396815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University