View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5869-6 (Length: 111)
Name: Solexa-NF5869-6
Description: NF5869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5869-6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 42713546 - 42713650
Alignment:
| Q |
1 |
ttgttaggatcaacagtaccatgccccattcgagaacccttccttagaaatggttttgactccaatggaactacactgcttttcttggtccccttgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42713546 |
ttgttaggatcaacagtaccatgccccattcgagaacccttccttagaaatggttttgactccaatggaactacactgcttttcttggtccccttgttac |
42713645 |
T |
 |
| Q |
101 |
ctatg |
105 |
Q |
| |
|
||||| |
|
|
| T |
42713646 |
ctatg |
42713650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University