View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5870-12 (Length: 133)
Name: Solexa-NF5870-12
Description: NF5870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5870-12 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 1e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 1e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 39000934 - 39001066
Alignment:
| Q |
1 |
gtttagatgttggaattttagttaatggtgctggtgtggcttatccttatgctagattttttcatgaggttgatttggatttgatggatactattatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000934 |
gtttagatgttggaattttagttaatggtgctggtgtggcttatccttatgctagattttttcatgaggttgatttggatttgatggatactattatcaa |
39001033 |
T |
 |
| Q |
101 |
agtgaatgttgaaggaacaacttggattactaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39001034 |
agtgaatgttgaaggaacaacttggattactaa |
39001066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 38996303 - 38996432
Alignment:
| Q |
1 |
gtttagatgttggaattttagttaatggtgctggtgtggcttatccttatgctagattttttcatgaggttgatttggatttgatggatactattatcaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38996303 |
gtttagatgtgggaattttagttaatagtgctggtgtggcttacccttatgctagattttttcatgaggttgatttggatttgatggatgctattatcaa |
38996402 |
T |
 |
| Q |
101 |
agtgaatgttgaaggaacaacttggattac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38996403 |
agtgaatgttgaaggaacaacttggattac |
38996432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University