View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5870-8 (Length: 146)
Name: Solexa-NF5870-8
Description: NF5870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5870-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 46996321 - 46996466
Alignment:
| Q |
1 |
cacagagagatctcgtttcttatgaagacannnnnnnnnnnaactattcttatgatgatgataaaaagagtcggctgccaaaattgaataagaaagaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46996321 |
cacagagagatctcgtttcttatgaagacatttttttttttaactattcttatgatgatgataaaaagagtcggctgccaaaattgaataagaaagaagg |
46996420 |
T |
 |
| Q |
101 |
ttcgtcgaagttgttgtgagtagaacgtgaatcccacccaaaaaag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46996421 |
ttcgtcgaagttgttgtgagtagaacgtgaatcccactcaaaaaag |
46996466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University