View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-10 (Length: 161)
Name: Solexa-NF5871-10
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 7e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 7e-66
Query Start/End: Original strand, 7 - 145
Target Start/End: Original strand, 43583820 - 43583958
Alignment:
| Q |
7 |
attatgacccatgattcatgagtttctgttcactcattttgaattccacaagtaactcacgtggaattccagttgttggcaaatcttgtcaccaggttta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43583820 |
attatgacccatgattcatgagtttctgttcactcattttgaattccacaagtaactcaaatggaaatccagttgttggcaaatcttgtcaccaggttta |
43583919 |
T |
 |
| Q |
107 |
tgagcactagacacaagattagagtatggctgatatatc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43583920 |
tgagcactagacacaagattagagtatggctgatatatc |
43583958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 9752294 - 9752255
Alignment:
| Q |
105 |
tatgagcactagacacaagattagagtatggctgatatat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9752294 |
tatgagcactagacacaagattagagtatagctgatatat |
9752255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 105 - 145
Target Start/End: Complemental strand, 12783644 - 12783604
Alignment:
| Q |
105 |
tatgagcactagacacaagattagagtatggctgatatatc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12783644 |
tatgagcactagacacaagattagagtatagctgatatatc |
12783604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University