View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-11 (Length: 159)
Name: Solexa-NF5871-11
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 49201520 - 49201585
Alignment:
| Q |
8 |
ttgatttggtacaacaagagcagttggtgagnnnnnnnactcacgtaaccgaccggacccccaacc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49201520 |
ttgatttggtacaacaagagcagttggtgagcccccccactcacgtaaccgaccggacccccaacc |
49201585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University