View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-19 (Length: 148)
Name: Solexa-NF5871-19
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 24523908 - 24524059
Alignment:
| Q |
1 |
cacagacaatctatgaacatatattttgagctgccgtttacaagatggatacata--gatatgtgcc-aatttttatcc--ttttaatattgcatactta |
95 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
24523908 |
cacagacaatctatgaacatat--tttgagctgccgtttacaagatggatacatatagatatgtgcctaatttttattcctttttaatattgcatactta |
24524005 |
T |
 |
| Q |
96 |
t-ctttttgttgatacttaatagagaataaatgcataaataaaccatgttgaag |
148 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24524006 |
ttctttttgttgatacttaatagagaataaatgtataaataaaccatgttgaag |
24524059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University