View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-2 (Length: 227)
Name: Solexa-NF5871-2
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 7165182 - 7165403
Alignment:
| Q |
6 |
caaattcgtttctatacacgtcgtcgtgacccttttcccacaaaaatcactcactaccttaaccgcgctaagctcatcgattcaattcggctttcactac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7165182 |
caaattcgtttctatacacgtcgtcgtgacccttttcccacaaaaatcactcactaccttaaccgtgctaagctcatcgattcaattcggctttcactac |
7165281 |
T |
 |
| Q |
106 |
gttccaataaccctaattccacactccccactctcataaaccaccgtttattcgactcattcgtcctcactcacgctcttcgttctgccccttgtgcaga |
205 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165282 |
gttccaataaccctaattccacactctccactctcataaaccaccgtttattcgactcattcgtcctcactcacgctcttcgttctgccccttgtgcaga |
7165381 |
T |
 |
| Q |
206 |
ttctgcactttcccttattcat |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7165382 |
ctctgcactttcccttattcat |
7165403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University