View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-32 (Length: 138)
Name: Solexa-NF5871-32
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-32 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 9e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 11 - 138
Target Start/End: Original strand, 46912493 - 46912620
Alignment:
| Q |
11 |
atgaagcttctagttatagggtgaaggaaaggaactatccatcatgagaaggatgtgtaccaggattgtctggaatgaattgacatccaaataagtcatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46912493 |
atgaagcttctagttatagggtgaaggaaaggaactatccatcatgagaaggatgtgtactaggattgtctggaatgaattgacatccaaataagtcatc |
46912592 |
T |
 |
| Q |
111 |
gtgtctataatacactgcgcactggaaa |
138 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
46912593 |
gtgtctataatacactgggcactggaaa |
46912620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University