View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-35 (Length: 137)
Name: Solexa-NF5871-35
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-35 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 33041798 - 33041662
Alignment:
| Q |
1 |
cacagacattaatattgtgaacttacttggtgttatttagttgtggtgagagtaatgtttcattgtctcatttagtttgagttacttaaaaatggttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33041798 |
cacagacattaatattgtgaacttacttggtgttatttagttatggtgagagtaatgtttcattgtctcatttagtttgagttacctaaaaatggttgtt |
33041699 |
T |
|
| Q |
101 |
ttatggtgtgtttggatggaaagtttaggaggggaag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33041698 |
ttatggtgtgtttggatggaaagtttaggaggggaag |
33041662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 137
Target Start/End: Original strand, 9426985 - 9427019
Alignment:
| Q |
103 |
atggtgtgtttggatggaaagtttaggaggggaag |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9426985 |
atggtgtgtttggattgaaagtttaggaggggaag |
9427019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 100 - 137
Target Start/End: Original strand, 41039947 - 41039984
Alignment:
| Q |
100 |
tttatggtgtgtttggatggaaagtttaggaggggaag |
137 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
41039947 |
tttagggtgtgtttggatggaaggtttaggaggggaag |
41039984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 12234257 - 12234220
Alignment:
| Q |
100 |
tttatggtgtgtttggatggaaagtttaggaggggaag |
137 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12234257 |
tttatggtgtgtttggatggagggtttaggaggggaag |
12234220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 105 - 137
Target Start/End: Complemental strand, 34634385 - 34634353
Alignment:
| Q |
105 |
ggtgtgtttggatggaaagtttaggaggggaag |
137 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
34634385 |
ggtgtgtttggatggagagtttaggaggggaag |
34634353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University