View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-40 (Length: 132)
Name: Solexa-NF5871-40
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-40 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0039 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 3 - 132
Target Start/End: Complemental strand, 24144 - 24015
Alignment:
| Q |
3 |
aatcagagaagcaacaaggttgaaatttgtccataccccacttaaagaaactccttttatacccaaattaagatatataacnnnnnnntaatttattggt |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24144 |
aatcaaagaagcaacaaggttgaaatttgtccataccccacttaaagcaactccttttatacccaaattaagatatataacaagaaaataatttattggt |
24045 |
T |
|
| Q |
103 |
atgtgaagaaggattgaaaaagttgcacaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24044 |
atgtgaagaaggattgaaaaagttgcacaa |
24015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 4 - 49
Target Start/End: Original strand, 45845974 - 45846019
Alignment:
| Q |
4 |
atcagagaagcaacaaggttgaaatttgtccataccccacttaaag |
49 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45845974 |
atcaaagatgcaacaaggttgaaatttgtccacaccccacttaaag |
45846019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University