View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-51 (Length: 123)
Name: Solexa-NF5871-51
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-51 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 10 - 123
Target Start/End: Original strand, 49168347 - 49168460
Alignment:
| Q |
10 |
gcgaaatagtagctagctactacatctctttaactggaatctagcttcgattgtcatccacatgtgaaatgtcatcggaacaaattatcggtaactgcta |
109 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49168347 |
gcgaaatagtagctagctactagatctctttaactcgaatctagcttcgattgtcatccacatgtgaaatttcatcggaacaaattatcggtaactgcta |
49168446 |
T |
 |
| Q |
110 |
ttataccttatgta |
123 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49168447 |
ttataccttatgta |
49168460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University