View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-54 (Length: 120)
Name: Solexa-NF5871-54
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-54 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0039 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 23873 - 23979
Alignment:
| Q |
8 |
tgttttttaaccaagatgaagaaatagcaacaatggctcaaacttatattctatattcaattcctgatcttattgctcaatcctttattcaccctttgag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23873 |
tgttttttaaccaagatgaagaaatagcaacaatggctcaaacttatattctatattcaattcctgatcttattgctcaatcctttatacaccctttgag |
23972 |
T |
|
| Q |
108 |
aatttac |
114 |
Q |
| |
|
||||||| |
|
|
| T |
23973 |
aatttac |
23979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 119
Target Start/End: Complemental strand, 45846234 - 45846133
Alignment:
| Q |
18 |
ccaagatgaagaaatagcaacaatggctcaaacttatattctatattcaattcctgatcttattgctcaatcctttattcaccctttgagaatttacctt |
117 |
Q |
| |
|
|||||| ||||| ||||| ||| ||||||| ||| |||||||||| ||||||||||| | || ||||| ||| | |||||||| |||||||||||| |
|
|
| T |
45846234 |
ccaagaagaagatatagctacacaagctcaaatctatcttctatattccattcctgatctcttagcacaatcgtttttacaccctttaagaatttacctt |
45846135 |
T |
|
| Q |
118 |
ag |
119 |
Q |
| |
|
|| |
|
|
| T |
45846134 |
ag |
45846133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University