View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-56 (Length: 119)
Name: Solexa-NF5871-56
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-56 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0039 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 24486 - 24368
Alignment:
| Q |
1 |
gaagctgaaagaaagtcctgaaattgctgaaagtttcgcttttgatggcttttgtgcacctatcatgttaccaactcttgttgaaacactattgcttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24486 |
gaagctgaaagaaagtcctgaaattgctgaaagttttgcttttgatggcttttgtgcacctatcatgttaccaactcttgttgaaacactattgcttagt |
24387 |
T |
|
| Q |
101 |
gaatatggaaaaatgtaca |
119 |
Q |
| |
|
|| || ||||||||||||| |
|
|
| T |
24386 |
gagtaaggaaaaatgtaca |
24368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.0000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 45845652 - 45845721
Alignment:
| Q |
22 |
aattgctgaaagtttcgcttttgatggcttttgtgcacctatcatgttaccaactcttgttgaaacacta |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| | ||||||||||||| || ||||||||| |
|
|
| T |
45845652 |
aattgctgaaagttttgcttttgatggcttttgagcaccaagtttgttaccaactctagtggaaacacta |
45845721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University