View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-60 (Length: 111)
Name: Solexa-NF5871-60
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-60 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 3 - 111
Target Start/End: Complemental strand, 9412535 - 9412430
Alignment:
| Q |
3 |
aagaagacgaaaaacaacaacggttgtttctgccgatgctgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaaccatggtgct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9412535 |
aagaagacgaaaaacaacaacggttgttgttgccgatg---atttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaacgatggtgct |
9412439 |
T |
 |
| Q |
103 |
aaccatcgc |
111 |
Q |
| |
|
||| ||||| |
|
|
| T |
9412438 |
aactatcgc |
9412430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 91
Target Start/End: Original strand, 51120325 - 51120372
Alignment:
| Q |
44 |
atttttatttacctgatgaatgttgggaaagtatcttcaaattcctca |
91 |
Q |
| |
|
|||| |||||||||||||| ||||||||| || ||||||||||||||| |
|
|
| T |
51120325 |
atttctatttacctgatgactgttgggaatgtgtcttcaaattcctca |
51120372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 39 - 98
Target Start/End: Complemental strand, 7561391 - 7561332
Alignment:
| Q |
39 |
tgctgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaaccatgg |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || | ||||||| ||||||||| |||| |
|
|
| T |
7561391 |
tgctgatttttatttacctgatgactgttggaaacatgtcttcaagttcctcaacaatgg |
7561332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 86
Target Start/End: Complemental strand, 10616246 - 10616209
Alignment:
| Q |
49 |
tatttacctgatgaatgttgggaaagtatcttcaaatt |
86 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
10616246 |
tatttacctgatgagtgttgggaatgtatcttcaaatt |
10616209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000003; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 554146 - 554097
Alignment:
| Q |
42 |
tgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctca |
91 |
Q |
| |
|
||||||||| || |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
554146 |
tgatttttactttcctgatgaatgttgggaatttgtcttcaaattcctca |
554097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 566795 - 566754
Alignment:
| Q |
46 |
ttttatttacctgatgaatgttgggaaagtatcttcaaattc |
87 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
566795 |
ttttatttacctgatgactgttgggaacgtgtcttcaaattc |
566754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 92
Target Start/End: Complemental strand, 642393 - 642341
Alignment:
| Q |
40 |
gctgatttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaa |
92 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | |||||||| || ||||| |
|
|
| T |
642393 |
gctgagttttatttacctgatgaatgttgggagtgcatcttcaattttctcaa |
642341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 1488821 - 1488868
Alignment:
| Q |
46 |
ttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaac |
93 |
Q |
| |
|
||||||||||||||||| || |||||| || || |||||||||||||| |
|
|
| T |
1488821 |
ttttatttacctgatgagtgctgggaatgtgtcgtcaaattcctcaac |
1488868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 93
Target Start/End: Original strand, 45244521 - 45244570
Alignment:
| Q |
44 |
atttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaac |
93 |
Q |
| |
|
|||| |||||||||||||| ||||||||| || |||| |||||||||||| |
|
|
| T |
45244521 |
atttctatttacctgatgagtgttgggaatgtgtcttgaaattcctcaac |
45244570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 89
Target Start/End: Original strand, 41886296 - 41886336
Alignment:
| Q |
49 |
tatttacctgatgaatgttgggaaagtatcttcaaattcct |
89 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
41886296 |
tatttacctgatgagtgttgggaatgtgtcttcaaattcct |
41886336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 47 - 90
Target Start/End: Complemental strand, 29022176 - 29022133
Alignment:
| Q |
47 |
tttatttacctgatgaatgttgggaaagtatcttcaaattcctc |
90 |
Q |
| |
|
||||||||||||| || ||||||||| | ||||||||||||||| |
|
|
| T |
29022176 |
tttatttacctgacgagtgttgggaatgcatcttcaaattcctc |
29022133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 41900191 - 41900234
Alignment:
| Q |
49 |
tatttacctgatgaatgttgggaaagtatcttcaaattcctcaa |
92 |
Q |
| |
|
|||||||| ||||| ||||||||| || |||||||||||||||| |
|
|
| T |
41900191 |
tatttaccagatgagtgttgggaatgtgtcttcaaattcctcaa |
41900234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 17642611 - 17642658
Alignment:
| Q |
46 |
ttttatttacctgatgaatgttgggaaagtatcttcaaattcctcaac |
93 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
17642611 |
ttttatttacctgatgagtgttgggagtctgtcttcaaattcctcaac |
17642658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University