View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5871-9 (Length: 162)
Name: Solexa-NF5871-9
Description: NF5871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5871-9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 5e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 5e-36
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 41759998 - 41760086
Alignment:
| Q |
1 |
catagactgattgatttccgttgtagatgttcattcttggtaagatagtccattactttgtttaggattgtcgactttgtaatcttggc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41759998 |
catagactgattgatttccgttgtagatgttcattcttggtaaactagcccattactttgtttaggattgtcgactttgtaatcttggc |
41760086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 87 - 162
Target Start/End: Original strand, 41760142 - 41760209
Alignment:
| Q |
87 |
ggcacgtcttgtgatttataaggaagttagttattattgtttgttttttcctcttaaaaaaccggactaaaatgaa |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||||||||||| ||||||||||||| |
|
|
| T |
41760142 |
ggcacgtcttgtgattcataaggaagttagttttt--------ttttttcctcttaaaaaactggactaaaatgaa |
41760209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University