View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-1 (Length: 273)
Name: Solexa-NF5872-1
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 39300037 - 39299908
Alignment:
| Q |
8 |
gcatgtcccatcaaatattctctcatgattggcaagtcatttacagaatccttgtgtacgtatgaacaagatttttgtaccattggagctttatccaatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300037 |
gcatgtcccatcaaatattctctcatgattggcaagtcatttacagaatccttgtgtacgtatgaacaagatttttgtaccattggagctttatccaatt |
39299938 |
T |
|
| Q |
108 |
gaccggggtatgacaggcatgggaagttct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39299937 |
gaccggggtatgacaggcatgggaagttct |
39299908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 138 - 273
Target Start/End: Complemental strand, 39262343 - 39262206
Alignment:
| Q |
138 |
aagcttgtatcggtcttgctcactcaacttgtccccttgttcat--ctcactcgacaaacacaccatataggcagttcttggtctaggacccctagtgat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39262343 |
aagcttgtatcggtcttgctcactcaacttgtccccttgttcatgtctcactcaacaaacacaccatatgggcagttcttggtctaggacccctagtgat |
39262244 |
T |
|
| Q |
236 |
catcaacctagctcgacaatcagcccttccaacgtccg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
39262243 |
catcaacctagctcgacaatcagcccttctaaagtccg |
39262206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University