View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-11 (Length: 156)
Name: Solexa-NF5872-11
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 6 - 156
Target Start/End: Complemental strand, 41404427 - 41404277
Alignment:
| Q |
6 |
caataagaacatcgtgtagaatgaatcctaaggactcaagattaggcatagacaaattgcttcttgaaaacatacgagcatgcctactcttgtgaatctt |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404427 |
caataagaacatcgtgtagaataaatcctaaggactcaagattaggcatagacaaattgcttcttgaaaacatacgagcatgcctactcttgtgaatctt |
41404328 |
T |
 |
| Q |
106 |
atcatcgtttgtcaatcttaagcttttagacttcgagctttgccacttgat |
156 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404327 |
atcatcatttgtcaatcttaagcttttagacttcgagctttgccacttgat |
41404277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University