View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5872-12 (Length: 143)

Name: Solexa-NF5872-12
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5872-12
Solexa-NF5872-12
[»] chr3 (7 HSPs)
chr3 (1-143)||(36001875-36002017)
chr3 (32-80)||(23446685-23446733)
chr3 (32-79)||(23453461-23453508)
chr3 (32-79)||(23477985-23478032)
chr3 (32-79)||(23498434-23498481)
chr3 (32-79)||(23351382-23351429)
chr3 (33-79)||(23385721-23385767)
[»] chr4 (1 HSPs)
chr4 (1-135)||(12897501-12897635)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 1e-70; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 36001875 - 36002017
Alignment:
1 gagatgaacaatcattgagactgagtgatttaagagattttgaatgaatgttggttttcaggcttttaatctttttgcagccgtctaaacgtagataact 100  Q
    |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36001875 gagatgaacaattattgagactgagtgattcaagagattttgaatgaatgttggttttcaggcttttaatctttttgcagccgtctaaacgtagataact 36001974  T
101 aagcttgggggcagtcaaaatggattcatggagtttacagaga 143  Q
    |||||||||||||||||||||||||||||||||||||||||||    
36001975 aagcttgggggcagtcaaaatggattcatggagtttacagaga 36002017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 32 - 80
Target Start/End: Original strand, 23446685 - 23446733
Alignment:
32 aagagattttgaatgaatgttggttttcaggcttttaatctttttgcag 80  Q
    ||||||||||||||||||||||||||| ||||||| |||||||||||||    
23446685 aagagattttgaatgaatgttggttttaaggctttcaatctttttgcag 23446733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 23453461 - 23453508
Alignment:
32 aagagattttgaatgaatgttggttttcaggcttttaatctttttgca 79  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||||||    
23453461 aagagattttgaatgaatgttggttttaaggctttcaatctttttgca 23453508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 23477985 - 23478032
Alignment:
32 aagagattttgaatgaatgttggttttcaggcttttaatctttttgca 79  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||||||    
23477985 aagagattttgaatgaatgttggttttaaggctttcaatctttttgca 23478032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 23498434 - 23498481
Alignment:
32 aagagattttgaatgaatgttggttttcaggcttttaatctttttgca 79  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||||||    
23498434 aagagattttgaatgaatgttggttttaaggctttcaatctttttgca 23498481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 23351382 - 23351429
Alignment:
32 aagagattttgaatgaatgttggttttcaggcttttaatctttttgca 79  Q
    ||||||||||||||||||||||||||| ||||||| ||||||| ||||    
23351382 aagagattttgaatgaatgttggttttaaggctttcaatctttatgca 23351429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 33 - 79
Target Start/End: Original strand, 23385721 - 23385767
Alignment:
33 agagattttgaatgaatgttggttttcaggcttttaatctttttgca 79  Q
    |||||||||||||||||||||| ||| ||||||| ||||||| ||||    
23385721 agagattttgaatgaatgttggatttaaggctttcaatctttatgca 23385767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 12897635 - 12897501
Alignment:
1 gagatgaacaatcattgagactgagtgatttaagagattttgaatgaatgttggttttcaggcttttaatctttttgcagccgtctaaacgtagataact 100  Q
    |||||||||||||| ||||   ||||| |   |||||||||||||||||||| ||||||||||||| |||||||||||| || | ||||  ||| |  ||    
12897635 gagatgaacaatcagtgagctcgagtgttcggagagattttgaatgaatgttagttttcaggctttcaatctttttgcaaccttttaaatatagttctct 12897536  T
101 aagcttgggggcagtcaaaatggattcatggagtt 135  Q
    |||||| |||||||| |||||||||  ||||||||    
12897535 aagcttcggggcagtgaaaatggatggatggagtt 12897501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University