View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-14 (Length: 140)
Name: Solexa-NF5872-14
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 8e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 7 - 140
Target Start/End: Original strand, 52626570 - 52626702
Alignment:
| Q |
7 |
atgaatggtactagtattacctaaggcaaaggtaaactgctgcatgttgttaaaacattgaaatgcatgtattaatttgttctctatatgttgccactct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52626570 |
atgaatggtactagtattacctaaggcaaaggtaaactgctgcatggtgttaaa-cattgaaatgcatgtattaatttgttctctatatgttgccactct |
52626668 |
T |
|
| Q |
107 |
aagagggtggaattgaagagacagaaccccacta |
140 |
Q |
| |
|
|||||| ||||||||||||||| || |||||||| |
|
|
| T |
52626669 |
aagaggatggaattgaagagactgatccccacta |
52626702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University