View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-15 (Length: 140)
Name: Solexa-NF5872-15
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 33694280 - 33694418
Alignment:
| Q |
1 |
atgaaatccaagaagacaggacgtgagtgtttagatgccatgcaaacaatgacgaaattaaaaaggaaacagcctcctcgttgcgtgcatgggagggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33694280 |
atgaaatccaagaagacaggacgtgagtgtttagatgccatgcaaacaatgacgaaattaaaaaggaaacagcctcctcgttgcgtgcatgggagggata |
33694379 |
T |
 |
| Q |
101 |
cctttccataatcaatcaaaccattcagtcgccacgtgtt |
140 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33694380 |
cctttccataatcaatc-aaccattcagtcgccacgtgtt |
33694418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University