View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5872-18 (Length: 137)

Name: Solexa-NF5872-18
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5872-18
Solexa-NF5872-18
[»] chr5 (1 HSPs)
chr5 (7-111)||(1498384-1498485)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 7 - 111
Target Start/End: Original strand, 1498384 - 1498485
Alignment:
7 gtatcatagagtatttccctatcccttataatgatatgagaaaaagaaactaaaataatactagaaagaagatagaataacaaatgggcacgcggatggt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||| ||||||||| | | |||||    
1498384 gtatcatagagtatttccctatcccttataatgatatgagaaaaagaaactaaaataa---tagaaagaagatagaataataaatgggcaagggtatggt 1498480  T
107 aagaa 111  Q
    |||||    
1498481 aagaa 1498485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University