View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-18 (Length: 137)
Name: Solexa-NF5872-18
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 7 - 111
Target Start/End: Original strand, 1498384 - 1498485
Alignment:
| Q |
7 |
gtatcatagagtatttccctatcccttataatgatatgagaaaaagaaactaaaataatactagaaagaagatagaataacaaatgggcacgcggatggt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| | | ||||| |
|
|
| T |
1498384 |
gtatcatagagtatttccctatcccttataatgatatgagaaaaagaaactaaaataa---tagaaagaagatagaataataaatgggcaagggtatggt |
1498480 |
T |
 |
| Q |
107 |
aagaa |
111 |
Q |
| |
|
||||| |
|
|
| T |
1498481 |
aagaa |
1498485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University