View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-19 (Length: 136)
Name: Solexa-NF5872-19
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 52479428 - 52479299
Alignment:
| Q |
7 |
aaatacctagagcttaaatagaatcttcgaagcagtaattaggtgcattaattgtgataatgtgatggaatatggttaacaaattcttctcaaatgttat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52479428 |
aaatacctagagcttaaatagaatcttcgaagcagtaattaagtgcattaattgtgataatgtgatggaatatggttcacaaattcttctcaaatgttat |
52479329 |
T |
|
| Q |
107 |
cgttccaattttttggtatgttccttgatc |
136 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |
|
|
| T |
52479328 |
cgtttcaattttttggtatgttcctcgatc |
52479299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University