View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-22 (Length: 127)
Name: Solexa-NF5872-22
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 33695093 - 33694975
Alignment:
| Q |
8 |
gttactattattatttcctttgttacctcctattcctaattaaaatgagggctggtgtatcctatttatatatccattcctttttggttgcttcttgtca |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33695093 |
gttactattattctttcctttgttacctcctattcctaattaaaatgagggctggtgtatcctatttatatatccattcctttttggttgcttcttgtca |
33694994 |
T |
|
| Q |
108 |
ttaatttatcttgattaaa |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33694993 |
ttaatttatcttgattaaa |
33694975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University