View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-26 (Length: 122)
Name: Solexa-NF5872-26
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 3e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 4 - 118
Target Start/End: Complemental strand, 3659225 - 3659115
Alignment:
| Q |
4 |
atgaactagaatatacttgcatgattcagaagcaatttaaaattgacaacatgaaaacttggcatactgtttataaaattttggatgcttttcttctcat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3659225 |
atgaactagaatatacttgcatgattcagaagcaattcaaaattgacaacat---aacttggcatactgtttatgaaattttggatgctttttttctca- |
3659130 |
T |
|
| Q |
104 |
taaggagttctgtcc |
118 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
3659129 |
taaggagttttgtcc |
3659115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 68 - 122
Target Start/End: Complemental strand, 3652994 - 3652940
Alignment:
| Q |
68 |
tactgtttataaaattttggatgcttttcttctcattaaggagttctgtcctatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3652994 |
tactgtttataaaattttggatgcttttcttctcattaagaagttctgtcctatg |
3652940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University