View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5872-29 (Length: 120)
Name: Solexa-NF5872-29
Description: NF5872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5872-29 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 7e-53; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 14229640 - 14229752
Alignment:
| Q |
8 |
ctatagagataatataaattttgttggttgttgggtgtctttcacttgactttctcctttattaggacaatgtgtctttgtagtttgattctcgaggttt |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14229640 |
ctatagagataatataaattttgatggttgttgggtatctttcacttgactttctcctttattaggacaatgtgtctttgtagtttgattctcgaggttt |
14229739 |
T |
|
| Q |
108 |
aggtttgttttga |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14229740 |
aggtttgttttga |
14229752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 25 - 113
Target Start/End: Original strand, 14223139 - 14223227
Alignment:
| Q |
25 |
attttgttggttgttgggtgtctttcacttgactttctcctttattaggacaatgtgtctttgtagtttgattctcgaggtttaggttt |
113 |
Q |
| |
|
|||||| || ||||||| || |||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14223139 |
attttgatgattgttggatgcctttcatttgactttctcctttatcaggacaatgtgtctttgtagtttgattcttgaggtctaggttt |
14223227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 7e-22
Query Start/End: Original strand, 25 - 113
Target Start/End: Original strand, 14227345 - 14227433
Alignment:
| Q |
25 |
attttgttggttgttgggtgtctttcacttgactttctcctttattaggacaatgtgtctttgtagtttgattctcgaggtttaggttt |
113 |
Q |
| |
|
|||||| || ||| ||| || |||||||||||||| || |||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14227345 |
attttgatgattgctggatgcctttcacttgacttacttctttattaagacaatgtgtctttgtagtttgattcttgaggtttaggttt |
14227433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University